# DnaHelix3D

> DnaHelix3D needs the 3d feature as well (features = ["biology", "3d"]), which turns on fframes/3d.

Page: https://fframes-kit.pages.dev/docs/biology/dna-helix-3d/
Cargo feature: `biology` (`fframes-kit = { version = "..", features = ["biology"] }`)

`DnaHelix3D` needs the `3d` feature as well (`features = ["biology", "3d"]`), which turns on
`fframes/3d`. It renders the helix with `fframes::three_d` on every frame, on the CPU or, with
`wgpu`, on the GPU, into a `width` x `height` image around `center`.

- **Model:** the helix has B-DNA proportions, with ten pairs a turn and a minor and a major
  groove. Each pair is a rung of its two bases in `bases` colours, the same as `DnaHelix`.
  The rung runs between two backbones of beads in `strand_color`.
- **View:** the axis runs across the image and the camera fits the whole length. The camera
  looks from `elevation` degrees above while the helix turns `spin` degrees a second about
  its own axis.
- **Motion:** from `delay` the pairs build up from the left, one every `pair_time` seconds.
  Their beads grow, the backbone reaches over from the pair before, and the two bases meet
  in the middle.

Gallery scene: `DnaHelix3D`. Its five seconds of 24 pairs render on the CPU in about three
seconds on this machine's 32 threads.

Gallery clip of `DnaHelix3D`: https://fframes-kit.pages.dev/media/scenes/DnaHelix3D-9704d4c8.mp4

```rust
use fframes_kit::prelude::*;

fn helix<'a>(ui: &mut Ui<'a, '_, '_>) -> Svgr<'a> {
    ui.show(DnaHelix3D {
        sequence: "GATTACAGATTACA".into(),
        width: 1000.0,
        height: 420.0,
        spin: 20.0,
        ..ui.defaults()
    })
}
```

## API

Components are plain structs. Set the fields you need and fill the rest with `..ui.defaults()`: the defaults below come from the current theme (`theme.` values are fields of `Theme`).

### DnaHelix3D

| Field | Type | Default | Description |
| --- | --- | --- | --- |
| `sequence` | `String` | `"ATGCGTACCTGAATCGGATCCATG".into()` | Bases read from the left, one pair per letter (`A`, `T`, `G`, `C`); the partner base is the complement. |
| `delay` | `f32` | `0.0` | Seconds after the container's start before the first pair appears. |
| `center` | `(f64, f64)` | `(0.0, 0.0)` | The middle of the image, in units of `ui.space`. |
| `width` | `f32` | `1500.0` | Width of the rendered image in pixels. |
| `height` | `f32` | `560.0` | Height of the rendered image in pixels. |
| `spin` | `f32` | `40.0` | Rotation about the helix axis, in degrees per second. |
| `elevation` | `f32` | `12.0` | Angle of the camera above the helix, in degrees. |
| `pair_time` | `f32` | `0.12` | Seconds between one pair appearing and the next. |
| `bases` | `BaseColors` | `BaseColors::default()` | Colour of each base letter's rung half. |
| `strand_color` | `Color` | `theme.colors.text` | Colour of the two sugar-phosphate backbones. |
| `enter` | `Option<FadeIn>` | `None` | Fade in at the start; `None` for none. |
| `exit` | `Option<FadeOut>` | `None` | Fade out before the end; `None` for none. |

Feature `biology` · [Source](https://github.com/khanhthanhdev/fframes-kit/blob/main/fframes-kit/src/kits/biology/dna_3d.rs#L62)