# DnaHelix

> DnaHelix draws a double helix from the side, the first base of sequence at the left (the other strand is its complement, complement(base)).

Page: https://fframes-kit.pages.dev/docs/biology/dna-helix/
Cargo feature: `biology` (`fframes-kit = { version = "..", features = ["biology"] }`)

`DnaHelix` draws a double helix from the side, the first base of `sequence` at the left
(the other strand is its complement, `complement(base)`). Each turn is `pitch` pixels long and
ten base pairs; the strands twist `spin` turns a second, and the back of each strand is dimmer
than its front. With `scan` a reading light passes the pairs from `delay`, one every
`step_time` seconds, and writes the lit pair above and below the helix. From `unzip_at`
seconds the strands come apart from the left in `unzip_time` seconds and straighten, each half
of a pair staying with its strand; with `replicate` a new partner strand in `new_color` grows
along each of them behind the fork, its bases pairing with the old ones. The bases are
coloured by `bases` (`BaseColors`). Gallery scene: `DnaHelix` (it reads, then replicates).

Gallery clip of `DnaHelix`: https://fframes-kit.pages.dev/media/scenes/DnaHelix-a976eae1.mp4

```rust
use fframes_kit::prelude::*;
use fframes_kit::kits::biology::complement;

let strand = "ATGC";
assert_eq!(strand.chars().map(complement).collect::<String>(), "TACG");

fn replication<'a>(ui: &mut Ui<'a, '_, '_>) -> Svgr<'a> {
    ui.show(DnaHelix {
        sequence: "ATGCGTACCTGAATCGGATC".into(),
        unzip_at: Some(4.0),
        ..ui.defaults()
    })
}
```

## API

Components are plain structs. Set the fields you need and fill the rest with `..ui.defaults()`: the defaults below come from the current theme (`theme.` values are fields of `Theme`).

### DnaHelix

| Field | Type | Default | Description |
| --- | --- | --- | --- |
| `sequence` | `String` | `"ATGCGTACCTGAATCGGATCCATGCAGTTA".into()` | Bases read from the left, one pair per letter (`A`, `T`, `G`, `C`); the partner base is the complement. |
| `delay` | `f32` | `0.0` | Seconds after the container's start before the scan and unzip timings begin. |
| `center` | `(f64, f64)` | `(0.0, 0.0)` | The middle of the helix, in units of `ui.space`. |
| `pitch` | `f32` | `340.0` | Pixels along the axis for one full turn (ten base pairs). |
| `radius` | `f32` | `80.0` | Pixels from the axis to each strand. |
| `spin` | `f32` | `0.12` | Twist of the helix, in turns per second. |
| `scan` | `bool` | `true` | A reading light passes along the pairs and writes the lit pair's letters when `true`. |
| `step_time` | `f32` | `0.18` | Seconds the reading light spends on each pair. |
| `unzip_at` | `Option<f32>` | `None` | Seconds after `delay` when the strands start to come apart; `None` keeps the helix closed. |
| `unzip_time` | `f32` | `3.0` | Seconds the unzipping takes to travel from the left to the right end. |
| `replicate` | `bool` | `true` | A new partner strand grows along each separated strand behind the fork when `true`. |
| `bases` | `BaseColors` | `BaseColors::default()` | Colour of each base letter's rung half. |
| `strand_color` | `Color` | `theme.colors.text` | Colour of the two backbones. |
| `new_color` | `Color` | `theme.colors.highlight` | Colour of the newly built strands while replicating. |
| `lit_color` | `Color` | `theme.colors.title` | Colour the pair under the reading light is mixed toward. |
| `letter_style` | `TextStyle` | `letter_style` | The font of the lit pair's letters: family, size in pixels and weight. |
| `enter` | `Option<FadeIn>` | `None` | Fade in at the start; `None` for none. |
| `exit` | `Option<FadeOut>` | `None` | Fade out before the end; `None` for none. |

Feature `biology` · [Source](https://github.com/khanhthanhdev/fframes-kit/blob/main/fframes-kit/src/kits/biology/dna.rs#L87)