Translation

Cargo featurefeatures = ["biology"]

View Markdown Open in Claude Open in ChatGPT

Translation reads mrna into a protein. The ribosome slides onto the strand at the first AUG and reads the reading frame (reading_frame(mrna)) one codon every codon_time seconds from delay: a tRNA with the matching anticodon drops in carrying its amino acid (amino_acid(codon)), the chain moves over onto it and gains a bond, and the empty tRNA leaves. At the stop codon the ribosome comes apart and lets the chain go. The names of the chain (Met-Ala-Ser) are written under the ribosome as it grows. Gallery scene: Translation.

Translation demo, first frame — `Translation` 8.5 s

use fframes_kit::prelude::*;
use fframes_kit::kits::biology::{amino_acid, reading_frame};

assert_eq!(amino_acid("AUG"), Some("Met"));
assert_eq!(amino_acid("UAA"), None); // a stop codon
let (start, codons) = reading_frame("GCAUGUUUUGAC");
assert_eq!((start, codons), (2, vec!["AUG".into(), "UUU".into(), "UGA".into()]));

fn protein<'a>(ui: &mut Ui<'a, '_, '_>) -> Svgr<'a> {
    ui.show(Translation {
        mrna: "GAUGUUUGGCUAAC".into(),
        codon_time: 1.0,
        ..ui.defaults()
    })
}

API

Components are plain structs. Set the fields you need and fill the rest with ..ui.defaults(): the defaults below come from the current theme (theme. values are fields of Theme).

Translation

Field	Type	Default	Description
`mrna`	`String`	`"GCCAUGGCUUCGAAAUGGUAAGC".into()`	The mRNA written with `A`, `U`, `G`, `C`; the ribosome starts at its first `AUG` and stops at a stop codon.
`delay`	`f32`	`0.0`	Seconds after the container’s start before the ribosome begins to read.
`codon_time`	`f32`	`1.2`	Seconds the ribosome spends on each codon.
`center`	`(f64, f64)`	`(0.0, 0.0)`	The middle of the mRNA, in units of `ui.space`.
`spacing`	`f32`	`44.0`	Pixels between neighbouring bases along the mRNA.
`bases`	`BaseColors`	`BaseColors::default()`	Colour of each base letter.
`strand_color`	`Color`	`theme.colors.highlight`	Colour of the mRNA backbone.
`ribosome_color`	`Color`	`theme.colors.accent`	Colour of the ribosome.
`trna_color`	`Color`	`theme.colors.muted`	Colour of the tRNA molecules.
`amino_color`	`Color`	`Color::hex("#9775fa")`	Fill of the amino acid circles.
`base_style`	`TextStyle`	`base_style`	The font of the base letters: family, size in pixels and weight.
`amino_style`	`TextStyle`	`amino_style`	The font of the amino acid names on the circles: family, size in pixels and weight.
`chain_style`	`TextStyle`	`theme.typography.caption`	The font of the chain written under the mRNA: family, size in pixels and weight.
`text_color`	`Color`	`theme.colors.text`	Colour of the codon marks, amino acid outlines and chain text.
`enter`	`Option<FadeIn>`	`None`	Fade in at the start; `None` for none.
`exit`	`Option<FadeOut>`	`None`	Fade out before the end; `None` for none.

Feature biology · Source