DnaHelix3D

DnaHelix3D needs the 3d feature as well (features = ["biology", "3d"]), which turns on fframes/3d. It renders the helix with fframes::three_d on every frame, on the CPU or, with wgpu, on the GPU, into a width x height image around center.

• Model: the helix has B-DNA proportions, with ten pairs a turn and a minor and a major groove. Each pair is a rung of its two bases in bases colours, the same as DnaHelix. The rung runs between two backbones of beads in strand_color.
• View: the axis runs across the image and the camera fits the whole length. The camera looks from elevation degrees above while the helix turns spin degrees a second about its own axis.
• Motion: from delay the pairs build up from the left, one every pair_time seconds. Their beads grow, the backbone reaches over from the pair before, and the two bases meet in the middle.

Gallery scene: DnaHelix3D. Its five seconds of 24 pairs render on the CPU in about three seconds on this machine’s 32 threads.

DnaHelix3D 5 sPlayUnmuteCopy render command

use fframes_kit::prelude::*;

fn helix<'a>(ui: &mut Ui<'a, '_, '_>) -> Svgr<'a> {
    ui.show(DnaHelix3D {
        sequence: "GATTACAGATTACA".into(),
        width: 1000.0,
        height: 420.0,
        spin: 20.0,
        ..ui.defaults()
    })
}

API

Components are plain structs. Set the fields you need and fill the rest with ..ui.defaults(): the defaults below come from the current theme (theme. values are fields of Theme).

DnaHelix3D

Field	Type	Default	Description
sequence	String	"ATGCGTACCTGAATCGGATCCATG".into()	Bases read from the left, one pair per letter (A, T, G, C); the partner base is the complement.
delay	f32	0.0	Seconds after the container’s start before the first pair appears.
center	(f64, f64)	(0.0, 0.0)	The middle of the image, in units of ui.space.
width	f32	1500.0	Width of the rendered image in pixels.
height	f32	560.0	Height of the rendered image in pixels.
spin	f32	40.0	Rotation about the helix axis, in degrees per second.
elevation	f32	12.0	Angle of the camera above the helix, in degrees.
pair_time	f32	0.12	Seconds between one pair appearing and the next.
bases	BaseColors	BaseColors::default()	Colour of each base letter’s rung half.
strand_color	Color	theme.colors.text	Colour of the two sugar-phosphate backbones.
enter	Option<FadeIn>	None	Fade in at the start; None for none.
exit	Option<FadeOut>	None	Fade out before the end; None for none.

Feature biology · Source