DnaHelix

DnaHelix draws a double helix from the side, the first base of sequence at the left (the other strand is its complement, complement(base)). Each turn is pitch pixels long and ten base pairs; the strands twist spin turns a second, and the back of each strand is dimmer than its front. With scan a reading light passes the pairs from delay, one every step_time seconds, and writes the lit pair above and below the helix. From unzip_at seconds the strands come apart from the left in unzip_time seconds and straighten, each half of a pair staying with its strand; with replicate a new partner strand in new_color grows along each of them behind the fork, its bases pairing with the old ones. The bases are coloured by bases (BaseColors). Gallery scene: DnaHelix (it reads, then replicates).

DnaHelix 10 sPlayUnmuteCopy render command

use fframes_kit::prelude::*;
use fframes_kit::kits::biology::complement;

let strand = "ATGC";
assert_eq!(strand.chars().map(complement).collect::<String>(), "TACG");

fn replication<'a>(ui: &mut Ui<'a, '_, '_>) -> Svgr<'a> {
    ui.show(DnaHelix {
        sequence: "ATGCGTACCTGAATCGGATC".into(),
        unzip_at: Some(4.0),
        ..ui.defaults()
    })
}

API

Components are plain structs. Set the fields you need and fill the rest with ..ui.defaults(): the defaults below come from the current theme (theme. values are fields of Theme).

DnaHelix

Field	Type	Default	Description
sequence	String	"ATGCGTACCTGAATCGGATCCATGCAGTTA".into()	Bases read from the left, one pair per letter (A, T, G, C); the partner base is the complement.
delay	f32	0.0	Seconds after the container’s start before the scan and unzip timings begin.
center	(f64, f64)	(0.0, 0.0)	The middle of the helix, in units of ui.space.
pitch	f32	340.0	Pixels along the axis for one full turn (ten base pairs).
radius	f32	80.0	Pixels from the axis to each strand.
spin	f32	0.12	Twist of the helix, in turns per second.
scan	bool	true	A reading light passes along the pairs and writes the lit pair’s letters when true.
step_time	f32	0.18	Seconds the reading light spends on each pair.
unzip_at	Option<f32>	None	Seconds after delay when the strands start to come apart; None keeps the helix closed.
unzip_time	f32	3.0	Seconds the unzipping takes to travel from the left to the right end.
replicate	bool	true	A new partner strand grows along each separated strand behind the fork when true.
bases	BaseColors	BaseColors::default()	Colour of each base letter’s rung half.
strand_color	Color	theme.colors.text	Colour of the two backbones.
new_color	Color	theme.colors.highlight	Colour of the newly built strands while replicating.
lit_color	Color	theme.colors.title	Colour the pair under the reading light is mixed toward.
letter_style	TextStyle	letter_style	The font of the lit pair’s letters: family, size in pixels and weight.
enter	Option<FadeIn>	None	Fade in at the start; None for none.
exit	Option<FadeOut>	None	Fade out before the end; None for none.

Feature biology · Source